Occurrence record: BIN023

Material Sample of BYTHITIDAE | Brotulas recorded on 2017-10-07
   API

Dataset

Data resource Maximising fish detection with eDNA metabarcoding
Occurrence ID BIN023
Record type Material Sample
Supplied basis "MaterialSample"
License CC-BY 3.0 (Au)
Associated references http://dx.doi.org/10.1002/edn3.87
Presence/Absence PRESENT
Supplied as present

Event

Occurrence date 2017-10-07
End day of year 280
Date precision DAY
Start day of year 280

Taxonomy

Scientific name BYTHITIDAE
Identified to rank family
Supplied as "Genus"
Common name Brotulas
Kingdom Animalia
Phylum Chordata
Class Actinopterygii
Order Ophidiiformes
Family Bythitidae
Name match metric higherMatch
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Locality Browse Island North
Latitude -14.10443
Supplied as: "-14.10443"
Longitude 123.5469
Supplied as: "123.54690"
Datum EPSG:4326
Coordinate precision Unknown
Coordinate uncertainty (in metres) 10.0
Terrestrial true
Elevation Sea level
Biome TERRESTRIAL
Marine false
Country Code AU
Depth Surface

Additional properties

chimeracheck VSEARCH
environment(biome) Ocean
environment(feature) Intertidal zone
environment(material) Seawater
environment biome Ocean
environment feature Intertidal zone
environment material Seawater
experimental factor Fishes, diversity, water sample volume
geographiclocation(countryand/orsea,region) Australia, Browse Island
geographiclocation countryand orsea region Australia, Browse Island
investigationtype Eukaryote
libraryconstructionmethod Illumina single-end sequencing
nucleicacidextraction Qiagen Dneasy Blood & Tissue Kit
pcrconditions initial denaturation at 95�C for 5 min, followed by 40 cycles of 30 s at 95�C, 30 s at the primer annealing temperature 54�C, and 45 s at 72�C, with a final extension for 10 min at 72�C
pcrprimers 16S rDNA region (16SF/D 5? GACCCTATGGAGCTTTAGAC 3? and 16S2R - degenerate 5? CGCTGTTATCCCTADRGTAACT 3?; Berry et al. 2017, Deagle et al. 2021
primers 16S Fish
projectname Maximising fish detection with eDNA metabarcoding
reads 400
samplecollectiondevice Bottle
samplematerialprocessing Filtering seawater
samplesize 20700mL
sequence ACCAGGAGAGACCATGTTAAACACCCATAAACAAAGGACCAAACTAAGTGACCCCTCTTCCCCTGTCTTTGGTTGGGGCGACCACGGGGAAATACAAAACCCCCACGAGGATTGGGAACACCCACCCCTAAAACTAAGGGCAACAGCCCTAAGTATCAGAACATCTGACCAGAAAGATCCGGCACAAACCGATCAACGAACCG
sequencingmethod Illumina sequencing by synthesis
data type comment You are viewing a record derived from DNA analysis, if you want further info on this type of occurrence record please go to this page: https://www.ala.org.au/environmentaldna/
original scientific name Bythitidae - Species 1

User flagged issues 

    Data quality tests

    Test name Result
    Country inferred from coordinates Warning
    Geodetic datum assumed WGS84 Warning
    Taxon match higher rank Warning
    Show/Hide 79 passed properties
    Show/Hide 6 missing properties
    Show/Hide 36 tests that have not been run