Occurrence record: 102.100.100/138393:92b6e81e8205aa2b2169c865d323b060

Material Sample of Helotiales Nannf. recorded on 2019-12-10

API

Dataset

Data resource	Australian Microbiome ITS2 (Fungi) Dataset of Terrestrial Samples
Occurrence ID	102.100.100/138393:92b6e81e8205aa2b2169c865d323b060
Record type	Material Sample
Collector	Siegy Krauss
License	CC0
Presence/Absence	PRESENT
Organism quantity	4
Material sample ID	102.100.100/138393
Organism quantity type	DNA sequence reads

Event

Event ID	102.100.100/138393
Occurrence date	2019-12-10 Supplied date "2019-12-10T00:50:00Z"
End day of year	344
Date precision	DAY
Start day of year	344

Taxonomy

Scientific name	Helotiales Supplied scientific name "SH0982647.09FU"
Identified to rank	order
Kingdom	Fungi
Phylum	Ascomycota
Class	Leotiomycetes
Order	Helotiales
Name match metric	higherMatch
Scientific name authorship	Nannf.
Name parse type	OTU

Geospatial

Country	Australia
State or Territory	Western Australia
Latitude	-32.9237 Supplied as: "-32.9237"
Longitude	116.43931 Supplied as: "116.43931"
Datum	EPSG:4326
Coordinate precision	Unknown
Terrestrial	true
Biome	TERRESTRIAL
Marine	false
Country Code	AU

Additional properties

0000012	1 Conservation and Natural Environments
0000013	1.3 Other minimal use
0000014	Soil [ENVO_00001998]
0000028	Free-living
0000037	meth_3.1.1 (https://research.csiro.au/ambsm/)
0000091	https://data.bioplatforms.com//organization/australian-microbiome?q=sample_id:102.100.100/138393
dna sequence	CAACCCTCAAGCCTGGCTTGGTATTGGGCTTCGCCGTTTTGGCGGGCCTCTAAAATCAGTGGCGGTGCCGTCGAGGCCCTGAGCGTAGTAAATATCCTCGCTATAGGGACCCGGTGGTTGCTAGCCATGAACCCCCAACTCTCTAA

User flagged issues

Data quality tests

Test name	Result
Coordinate uncertainty meters invalid	Warning
Country inferred from coordinates	Warning
Geodetic datum assumed WGS84	Warning
Taxon match higher rank	Warning
Show/Hide 79 passed properties
Basis of record badly formed	Passed
CONTINENT_COORDINATE_MISMATCH	Passed
Continent country mismatch	Passed
Continent derived from coordinates	Passed
CONTINENT_DERIVED_FROM_COUNTRY	Passed
Continent invalid	Passed
Coordinates centre of country	Passed
Supplied coordinates centre of state	Passed
Coordinate invalid	Passed
Coordinates are out of range for species	Passed
Coordinates converted to WGS84	Passed
Decimal latitude/longitude conversion failed	Passed
Coordinate reprojection suspicious	Passed
Coordinate rounded	Passed
Coordinates dont match supplied country	Passed
Country invalid	Passed
Country mismatch	Passed
First of the century	Passed
First of the month	Passed
First of the year	Passed
Unrecognized geodetic datum	Passed
Georeferenced after occurrence date	Passed
Identification date before occurrence date	Passed
Interpretation error	Passed
Invalid scientific name	Passed
Location not supplied	Passed
Missing collection date	Passed
Multimedia date invalid	Passed
Multimedia uri invalid	Passed
Name not supplied	Passed
Occurrence status inferred from basis of record	Passed
Occurrence status inferred from individual count	Passed
Occurrence status unparsable	Passed
Latitude is negated	Passed
Longitude is negated	Passed
Presumed swapped coordinate	Passed
Recorded date invalid	Passed
Recorded date mismatch	Passed
Recorded date unlikely	Passed
SCIENTIFIC_NAME_AND_ID_INCONSISTENT	Passed
Sensitivity report invalid	Passed
Sensitivity report not loadable	Passed
Coordinates dont match supplied state	Passed
Taxon affinity species	Passed
TAXON_CONCEPT_ID_NOT_FOUND	Passed
Taxon confer species	Passed
Taxon default match	Passed
Taxon error	Passed
Taxon excluded	Passed
Taxon excluded associated	Passed
Taxon homonym	Passed
TAXON_ID_NOT_FOUND	Passed
Taxon indeterminate species	Passed
Taxon match aggregate	Passed
Taxon match fuzzy	Passed
TAXON_MATCH_NAME_AND_ID_AMBIGUOUS	Passed
Taxon match none	Passed
TAXON_MATCH_TAXON_CONCEPT_ID_IGNORED	Passed
TAXON_MATCH_TAXON_ID_IGNORED	Passed
Taxon misapplied	Passed
Taxon misapplied matched	Passed
Taxon parent child synonym	Passed
Taxon question species	Passed
Resource taxonomic scope mismatch	Passed
Taxon species plural	Passed
Coordinate precision and uncertainty transposed	Passed
Uncertainty not specified	Passed
Supplied country not recognised	Passed
Kingdom not recognised	Passed
Supplied coordinates are zero	Passed
Biosecurity issue	Passed
Suspected outlier	Passed
Geospatial issue	Passed
Habitat incorrect for species	Passed
Taxon misidentified	Passed
Taxonomic issue	Passed
Temporal issue	Passed
Other issue	Passed
Duplicate record	Passed
Show/Hide 7 missing properties
Missing geodetic datum	Missing
Missing georeferenced by	Missing
Missing georeference protocol	Missing
Missing georeference sources	Missing
Missing georeference verification status	Missing
Missing georeference date	Missing
Missing taxon rank	Missing
Show/Hide 34 tests that have not been run
Unrecognized collection code	Unchecked (lack of data)
Unrecognized institution code	Unchecked (lack of data)
Coordinate precision invalid	Unchecked (lack of data)
Footprint SRS invalid	Unchecked (lack of data)
Footprint WKT mismatch	Unchecked (lack of data)
Footprint WKT invalid	Unchecked (lack of data)
TAXON_MATCH_SCIENTIFIC_NAME_ID_IGNORED	Unchecked (lack of data)
SCIENTIFIC_NAME_ID_NOT_FOUND	Unchecked (lack of data)
Depth value supplied in feet	Unchecked (lack of data)
Depth unlikely	Unchecked (lack of data)
Min and max depth reversed	Unchecked (lack of data)
Depth value non-numeric	Unchecked (lack of data)
Elevation unlikely	Unchecked (lack of data)
Min and max altitude reversed	Unchecked (lack of data)
Altitude value supplied in feet	Unchecked (lack of data)
Altitude value non-numeric	Unchecked (lack of data)
Modified date invalid	Unchecked (lack of data)
Modified date unlikely	Unchecked (lack of data)
Identified date unlikely	Unchecked (lack of data)
Identified date invalid	Unchecked (lack of data)
Type status invalid	Unchecked (lack of data)
References uri invalid	Unchecked (lack of data)
Individual count invalid	Unchecked (lack of data)
Individual count conflicts with occurrence status	Unchecked (lack of data)
Georeferenced date unlikely	Unchecked (lack of data)
Georeferenced date invalid	Unchecked (lack of data)
Ambiguous institution	Unchecked (lack of data)
Ambiguous collection	Unchecked (lack of data)
Institution not matched	Unchecked (lack of data)
Collection not matched	Unchecked (lack of data)
Institution match fuzzy	Unchecked (lack of data)
Collection match fuzzy	Unchecked (lack of data)
Institution and Collection mismatch	Unchecked (lack of data)
Different owner institution	Unchecked (lack of data)

Group	Field Name	Original Value	Processed Value


Classification	Scientific name	SH0982647.09FU	Helotiales
	Match type		higherMatch
	Phylum id		NZOR-6-88401
	Taxon concept ID		NZOR-6-78047
	Order	Helotiales	Helotiales
	Taxon rank id		4000
	Left		679945
	Scientific name authorship		Nannf.
	Taxon rank		order
	Taxon ID	ASV:92b6e81e8205aa2b2169c865d323b060
	Name type		OTU
	Order id		NZOR-6-78047
	Right		682445
	Kingdom	Fungi	Fungi
	Class id		NZOR-6-124149
	Phylum	Ascomycota	Ascomycota
	Class	Leotiomycetes	Leotiomycetes
	Kingdom id		https://id.biodiversity.org.au/taxon/fungi/60119249
Event	Event ID	102.100.100/138393
	Year		2019
	End day of year		344
	Month		12
	Date precision		DAY
	Start day of year		344
	Day		10
	Event date	2019-12-10T00:50:00Z	2019-12-10
Occurrence	Occurrence status		PRESENT
	Basis of record	MATERIAL_SAMPLE	MATERIAL_SAMPLE
	Organism quantity	4
	Material sample ID	102.100.100/138393
	Occurrence ID	102.100.100/138393:92b6e81e8205aa2b2169c865d323b060
	Organism quantity type	DNA sequence reads	DNA sequence reads
	Recorded by	Siegy Krauss
Attribution	Data resource		Australian Microbiome ITS2 (Fungi) Dataset of Terrestrial Samples
	License		CC0
	Data Resource ID	dr23162	dr23162
Location	Country		Australia
	Decimal latitude	-32.9237	-32.9237
	Terrestrial	true	true
	Decimal longitude	116.43931	116.43931
	State province		Western Australia
	Biome		TERRESTRIAL
	Marine	false	false
	Country code		AU
	Geodetic datum		EPSG:4326